microbiology - Writing methods section on PCR amplication in a paper

Considering that I am writing a paper for a journal, could the following phrase be understood? or should I put the 'step-by-step' way by giving numbers?

PCR Amplification and sequencing

PCR reaction for sequencing with universal primer ITS5: F: (5’TCCTCCGCTTATTGATATGC3’ and ITS4:R: (5'TCCGTAGGTGAACCTGCG
C3'), including 5,8S rDNA region (White et al 1990). Amplification condition was performed in a 25 ml reaction volume and consisting of 10 µL nuclease free water, 12.5 µL Tag green master mix, 0,5 µL forward primer, 0,5 µL reverse primer, 0,5 µLDMSO, 1 µL template. Mixture solution was amplified by PCR machine (Biorad). Thermal cycle programmed for 90 seconds at 95°C as initial denaturation, followed by 35 cycles of 30 sec at 95°C for denaturation, 30 sec at 55 °C as annealing, 90 sec at 72 °C for extension, and final extension at 72 °C for 5 min. PCR products were examined by electrophoresis at 100 V for 30 minutes in a 1% (w/v) agarose gel in 1 x TAE buffer. The marker used DNA ladder 1 kb. Electrophoresis gel was soaked in ethidium bromide for 30 minutes then visualized in UV light.