exoplanet - Are all models of ocean planets theoretically cloud covered?

Having given this some thought, it's a bit of a monster question with a few variables that you don't mention. Planetary tilt, which causes seasons is one. Length of day, for example, a rotation like Venus' 116 days would be quite different than an earth rotation of 24 hours and a tidally locked planet would also be different. Atmospheric pressure is another. I'm assuming Earth like tilt, 24 hour day since you didn't mention, and 1 ATM, but I think, if and when we finally get a good look at earth-like exo-planets, which, granted, might be several decades away, I think we'll see a few unexpected things.

OK, moving on. Earth likely got much of it's atmosphere from comets which suggests healthy amounts of CO2, CH4 and NH3, maybe N2, some from the NO family, maybe some Helium, Argon and Neon, those 3 I think we can mostly ignore, some hydrogen perhaps from solar flares, which might get stripped along with the helium from the planet over time.

The total amount of comet and asteroid impacts and ratio of gasses add some variability and a really important factor is whether or not the planet has life and undergoes photosynthesis. Photosynthesis would put O2 into the atmosphere and reduce CO2 and would also have the effect of, over time, reacting with and eliminating the virtually all of the CH4 from the air and any dissolved Iron in the oceans, turning the oceans from a muddy brownish/red to clear blue. Photosynthesis likely played a key role in turning the Earth from a hot planet to a snowball.

So, lots of variables, but it's a fun speculative question, so I'll give it a shot.

How much smaller than Earth? I'm going to go with Venus size but if you have different in mind, let me know. .815 Earth masses, 6,052 km in Radius and gravity of .905 of Earth. Source.

10 miles deep oceans (16.09 km), surface area, 4 Pi R^2 about 7.4 billion cubic km of water. (Earth, by comparison, about 1.37 billion cubic km) Source. Your planet has about 5.4 times as much water as earth (not counting water in the crust, but you didn't mention that, so lets not go there) - and planet size doesn't affect the predictions much.

I wonder how much outgassed CO2 etc. would stay dissolved in the ocean
and how much would accumulate in the atmosphere? Nitrogen?

I'm going to assume that the theory is correct that Earth (and your water world) get most of it's atmosphere and water from asteroids and comets Source and Source, though the 2nd source suggests some could have come from the primordial material of the Earth. If your water-world has a lot of gas trapped below it's crust in it's primordial material, then out-gassing from volcanism becomes a bigger factor and the volcanoes, not the atmosphere above would keep the oceans saturated with gas. That's possible, but I'm going to assume that most of the gas is already in the atmosphere following a late heavy bombardment period. I'll touch a bit more on tectonics later.

Titan Probably got it's thick atmosphere from outgassing Source and perhaps Venus from a recent large outgassing event too - just throwing that out there.

I'm also assuming that your planet wouldn't have permanent ice over it's oceanic poles due to the warmish temperature you implied and likely oceanic circulation not blocked by land-masses would prevent ice formation.

Would it necessarily have a runaway greenhouse?

Greenhouse Gases, CO2, CH4, NO family, (H20, more indirectly)

If your planet has a lot of CO2/CH4, comparable amounts to the amount of H20, then it's unlikely the oceans could begin to dissolve enough gas and this would lead to a run-away Greenhouse, almost without question.

If your planet has more earth like CO2/CH4 levels, perhaps driven by photosynthesis capturing carbon and released oxygen chemically reacting with the CH4, then the runaway greenhouse can be avoided and CH4 be very low concentration. CH4 on Earth is currently about 1.8 PPM and prior to farming and livestock and oil drilling & Fracking which can release some CH4, it was probably less than half that much, less than 1 PPM. In a water world CH4 would probably be even less as there's no biodegrading or digestion of plant-mass releasing CH4.

CO2 is more complicated and the amount dissolved in the ocean depends on the total amount available. If there's not too much CO2 to saturate the oceans, then you have an ocean/air equilibrium which is also affected by temperature. For a more detailed answer on this, look into Henry's law, but I'm going to cheat and do a quick and dirty calculation rather than use Henry's.

on Earth, the oceans contain about 50 times the CO2 as the Atmosphere: Source. And the oceans weigh about 265-270 times more than the atmosphere. (ocean mass given above, atmosphere mass here.)

So if we estimate this as parts per million (ppm), the CO2 concentration in Earth's atmosphere is about 5 times the concentration in Earth's oceans, and at higher temperatures, that ratio goes up, lower temperatures it goes down, but it never gets to the point that there's no CO2 in the air, cause not possible in an equilibrium. With 10 mile deep oceans, we can assume a more CO2 in the oceans, maybe 99% vs about 98% ocean to air ratio currently on earth but the 1% in the air would depend on the total mass of CO2 in the water world's ecosystem, ignoring anything permanently trapped deep on the ocean floor, such as sea-shells.

Would such a world without land always be covered with clouds?

Lets say you have an Earth like Oxygen/Nitrogen atmosphere, 1 bar, a planet very similar to earth but just oceans. Similar weather (as a starting point), this planet should have more clouds as clouds are more common over the oceans, source, and you would have no low humidity/dry pockets of land, but I would think, probably not 100% clouds, just more clouds. The cloud effect on temperature has some uncertainty to it, as clouds both both reflect sunlight making the planet colder during the day and they trap heat at night, so they play for both the warming team and the cooling team, but what I've read, the overall effect is pretty small. Days could be colder, nights warmer.

Also, evaporation tends to cool the air at the surface, which is why islands surrounded by ocean don't ever get the scorching hot temperatures you get in death valley for example, even if they're closer to the equator, so you wouldn't get heatwaves, but you wouldn't get freezing cold either. (I would think).

Finally, oceans have lower albedo and a water-world earth would likely have no ice-caps, so, Overall, I think it's likely a water-world earth would be warmer primarily due to lower albedo and this would increase atmospheric water-vapor (not clouds but transparent water vapor, which is a greenhouse gas), so a water-earth would probably several degrees warmer on average with no ice-caps. How much warmer - I have no idea but I don't think a water-earth would be run-away greenhouse.

A water world (Earth) could also have less CO2 in the atmosphere due to more dissolved in water and probably less CH4 from decaying matter on land, so, it might actually be colder, but this would more likely depend on the life cycle's O2 to CO2 ratio rather than oceanic absorption of CO2. Too many unknowns to say for sure.

Another curious effect to a water world earth is you might get some hurricanes that last for weeks, maybe even months or years in the right conditions, kind of like mini versions of Jupiter's great red spot. All you need for a hurricane to gain strength is warm water and cold air and with no land for the Hurricane to lose strength on, You could get some real jumbos. Maybe category 7s, perhaps 8s. That would be awesome.

Now if (and I think this is the gist of your question), what happens if you decrease the atmospheric pressure by significantly lowering the amount of O2/N2 in the atmosphere (or raising it). Lower atmospheric pressure lowers the boiling point of water and if you lower the atmospheric pressure enough, then water starts to boil and you get a partial water vapor atmosphere as a result of low atmospheric pressure and lots of water. I suspect this is unlikely to actually happen as a planet should always have enough other types of gas to prevent this unlikely outcome but a water vapor atmosphere can be approached logically, even if it's not going to really happen. Now, this isn't just high humidity, this is an actual water vapor atmosphere.

I imagine a water-vapor rich atmosphere would form droplets and rain fairly regularly and be permanent or nearly permanent cloud cover but that's just a guess, though it would probably appear more like low to the ground smog than cloud cover, the clouds might hover much closer to the earth.

If you increase atmospheric pressure, then water has a higher boiling point and takes more energy to vaporize. A denser atmosphere might hold heat better and be a bit warmer. It might also have fewer clouds due to more air and perhaps less variation in temperature and circulation, as it's circulation and warm air cooling off that's the primary driver in cloud formation.

Water vapor would still form under a higher pressure atmosphere by wind and by photons. Sunlight plays an important role in evaporation, perhaps even more than temperature based on pan evaporation studies.

If you have a very thin atmosphere made almost entirely of water (getting back to our improbable example). You'd drown if you tried to breath it, but as far as temperature of such a planet, at least with earth temperatures, water stays liquid even at quite quite low atmospheric pressure.

At 1/2 PSI (1/29th of 1 atm) the boiling temperature of water is 79.6 degrees C. Source. I'm not sure how much heat 1/29th of an atmosphere could trap even if it was mostly water which is a greenhouse gas, so this one is hard to predict. You'd likely see wild night to daytime temperature swings, frequent boiling of the oceans during the day and very heavy rainfall at night, much more rain than we ever see on earth, as 1/29th of an ATM of water vapor is several times more water than is in the earth's atmosphere at any given time.

If a water-vapor atmosphere planet (unlikely), got enough heat from it's sun, it could certainly turn into a run-away greenhouse, but I'm not sure if that happens at the radiance earth gets. But a planet like this would probably be subject to bigger temperature swings than we see on Earth and very fast wind.

How about such a world with no vulcanism?

(Vulcanism - as in, spock, . . . sorry).

We think of plate tectonics and volcanism as a process by which gas is given to the atmosphere, and that's true to an extent. Certainly any gas trapped inside a planet at formation can be outgassed through Volcanism, but perhaps a more important aspect of plate tectonics isn't the release of gas but the absorption of gas. Oxygen is very reactive and it combines with basaltic rock to make lighter/stronger rock like granite and bedrock which leads to continents and mountain ranges and all that good stuff. Nitrogen can bind with basalt too, but Oxygen I think, binds more readily. Without photosynthesis and the creation of oxygen, not just life on earth but the continents would look very different and they'd probably be much less permanent.

So if all the volcanoes are under water, that limits the atmospheric absorption of oxygen and other gases to just what's disolved in the oceans which could be a lot of NH3, but relatively lower amounts of other gasses.

Another effect of all tectonic activity and volcanoes being under water is that volcanic gas like sulfates and tiny dust particles which can cool the planet after a large eruption, are unlikely to reach the atmosphere in any significant volume, so you're likely to avoid any volcanic cooling like you get on occasion on earth.

Finally, you might think that volcanoes under oceans would warm the oceans and they would locally, but not much overall. A significant percentage of Earth's volcanoes are under water, but because ocean water circulates, most of the deep oceans stay at a chilly 4 degrees C, as opposed to land which gets warmer as you dig into the ground. Convection circulates heat much faster than conduction.

Undersea volcanoes in your water world could be very helpful in the continuation and maintenance of extremophile life due to repleneshment of nutrients but not much in the way of temperature change or cloud formation.

Finally - a fun bit worth mentioning. NH3, which is a very common gas/ice in the solar system. It's in all the outer planets and comets and outer moons. The neat thing about NH3 is it's water soluble and it's an energy source to primitive life, so simply by having oceans, stinky but useful NH3 is fairly quickly, mostly removed from the atmosphere and dissolved in liquid oceans and if there's life, it can be consumed, some released as N2 or NO-family and some can be built into amino acids. Some nitrogen can bind with basaltic rock and magma from undersea volcanoes forming different types of rock, but I'm no geologist, so I'm not sure how much that would happen.

There's no one simple answer to this, but that's my best guess as a layman. I enjoy thinking about stuff like this.

galaxy - Why are galaxies disk shaped?

Galaxies are disc shaped because they are gas rich and dynamically young. Stars are also gas rich but they are dynamically old so they have had time to rid themselves of their discs. Young protostars (which are dynamically young) are surrounded by proto-stellar discs. The reason many young gas rich objects are disc shaped has to do the fact that circular orbits are compatible with no orbit crossing, hence no shocks. In some sense, many young astronomical objects are disc shaped because they contain(ed) gas which can radiate away non circular motion.

But a disc is not the most likely state of a gravitational system: given time, torquing, instabilities or viscous processes it will tend towards a more likely compact state, where mass flows inwards and angular momentum outwards. This is why proto-stellar discs become stars. Galaxies on the other hand have not had time to turn themselves into gigantic black holes, or been given the opportunity to do so via torquing with their environment.

When two gas poor disc galaxies collide they produce an elliptical which is not disc like. When two gas rich disc galaxies collide they produce a disc like galaxy with a bulge.

genetics - What generates variation in a species?

After mutations, which probably is the source of most variation. The classic biological model of variation comes from accidents of history and environment.

Many mutations disappear over time because they aren't helpful (advantageous). The reasons variations persist for more than a few generations is that our differences have helped us to live successful lives and (in biological terms of success) have offspring. In europe the lactate dehydrogenase gene and others like it that help people digest milk is active through adult life as the result of domestication of milk producing animals, in asia, this trait is rarer or non existent as agriculture does not produce milk there (in most cases).

This is a broad difference, but its true in smaller ways for all of our individual traits, or so the theory goes. Individual family traits are helpful to create stronger family bonds, so even something like distinctive dimples or foreheads have claim to being an advantageous trait. Its possible that blonde hair is the product of such an advantage - its a strong signal to paternity if the father is blonde for instance.

Another answer to your question I think, is that there are probably mechanisms in the cell or in mate selection that increase or decrease variation in the community at given times of stress. For instance, snakes are among the animals who have a particular ability to select gender depending upon the conditions the female is experiencing. more males may increase variation in the community - fewer males and more females will decrease it. (not by a lot mind you, but a bit).

Additional response added as requested:

I see what you are getting at - why do children seem like such individual and unique things sometimes?

In sexual reproduction, the offspring are the product of the shuffling of the parent's genomes through meiosis, where the pairs of chromosomes we have are combined to make a single chromosome that will be half of the children genome.

This process can result in completely novel combinations of genes while conveying many likenesses from the parent. I would guesstimate that this is the major cause of the uniqueness of offspring/children.

Also in mammals there are some cell lines which splice families of genes which will cause offspring to be potentially quite different from either parent. Immune genes for instance are created from scratch from a bunch of genes that the parents give. Making each offspring unique but also the product of the parent's genetic repertoire. This can be significant as it affects health and also to some extent attraction - studies have shown that people who smell attractive to us are immunologically distinct from us.

@David mentions epigenetic variation, which is a more recent significant development. During our life, the germline (sperm/egg) DNA may be chemically labelled depending upon environmental conditions we experience. A famous example is experiencing famine conditions, which caused the children to be born on the small side amongst other effects. More recent studies have shown that this is a widespread mechanism to control cells in our body during our lifetime as well as communicate to our offspring how life is. It is expected that this labeling does not affect us forever - the epigenetic labels change over the course of a generation quite often (we believe).

microbiology - Is there a free alternative to Gelcompar for comparing banding patterns across multiple gels?

In order to run my microbial community samples from my experiments through DGGE, I was required to use multiple gels.

Thus it is necessary to compare banding patterns across more than one gel. This means that I need some way of assessing whether the 4th band on gel #1 is the same OTU as the 4th band on gel #2.

The industry standard for this procedure seems to be the Gelcompar software. Unfortunately this software is greater than $10,000 and is proprietary (thus, not open science friendly).

Does there exist a free (ideally as in speech and beer) alternative to Gelcompar?

gravity - Are black holes solely responsible for hyper velocity stars?

I read that the stars orbiting around Sagittarius A* (a.k.a the supermassive black hole located at the heart of the Milky Way) move very fast (many times faster than our Sun moves across the galaxy), and it is believed they have enough speed to wander off. My question is, is any exception to this rule, where somehow some stars may break a stellar speed limit not due to a black hole in their vicinity?

human biology - Which aspects of renal physiology are standing in the way of an artificial (mechanical) kidney?

The problem is that real organs are just damn complex - yes the kidney's prime role is just to be a filter, but in order to do so it must be plugged in to a dozen regulation mechanisms - osmotic balance, ion management, protein management and a plethora of more subtle ones. Moreover it is a part of body, so it must also follow all the standard protocols to live with immune system, obtain necessary resources to its function and maintenance, cooperate with nearby tissues...

Currently we only have rough knowledge about major processes, deciphering them all is a work for many, many years (if it is not futile at all). Finally, our technology will be long not capable of implementing all those protocols; in peaks of perfection we can serially do simple parts in 100nm scale (microprocessors), while this is a scale of a complete molecular device.

bioinformatics - Using the IMGT/GENE-DB service to find RSS

I'm trying to get the data for the Human and Mouse 12 and 23 Recomination
Signal Sequences (RSS), to run a classification algorithm on it. I'm not a
biologist, so I apologise in advance for my misunderstandings and
confusion.

A version of the data is available here, but I thought I would try to
get it from www.imgt.org, if possible. There is also another slightly
different version available for the mouse here.

I'm trying to follow the instructions at IMGT-FAQ to obtain Recombination Signal
Sequences for the mouse.

Here is what I have selected at the search page:

Identification:
Species : Mus Musculus
GeneType: any
Functionality: functional
MolecularComponent: any
Clone name: <blank>

IMGT group: IGHV
IMGT subgroup: any
IMGT gene: <blank>

I'm not clear what "Locus", "Main locus", and
"IGMT group" mean here exactly. Specifically, what is the difference
between "Locus" and "Main locus"?

I think, but am not sure, that IGHV corresponds to V genes in the
Immunoglobulin heavy locus (IGH@) on chromosome 14, where locus here
denotes collections of genes. Clarifications and corrections appreciated.

I would have expected that the IGH locus would correspond to "IMGT group"
entries like "IGHJ, IGHV" etc, and the IGK locus would correspond to IMGT
group entries like "IGK, IGKJ, IGKV", but no matter what I select for
Locus, it does not change the possible entries for "IMGT group".

Running the search gives

Number of resulting genes : 218
Number of resulting alleles : 350

As instructed, I went to the bottom, selected "Select all genes", clicked
on "Choose label(s) for extraction", and selected "V-RS".

I got

Number of results=98

The first few results were

>X02459|IGHV1-4*02|Mus musculus_BALB/c|F|V-RS|395..432|38 nt|NR| | | | 
|38+0=38| | |
cacagtggtgcaaccacatcccgactgtgtcagaaacc

>X02064|IGHV1-54*02|Mus musculus|F|V-RS|295..332|38 nt|NR| | | | |38+0=38| 
| |
cacagtgttgcaaccacatcctgagtgtgtcagaaatc

>M34978|IGHV1-58*02|Mus musculus_A/J|P|V-RS|554..560|7 nt|NR| | | | 
|7+0=7|partial in 3'| |
cacagtg

Ok, now I'm confused. The lengths of the RSS should be 28 or 39. but I
counted lengths of 4,7, 31, 38, and 39. Are the results here not supposed
to contain the 12 and 23 RSS?

So, I must be misunderstanding things here. Possibly many things. Any
explanations and clarifications are appreciated.

cosmological inflation - Does the accelerating expansion of spacetime mean that the pace of time is changing?

To talk about 'the rate of time', we essentially need at least two different time coordinates. For example, this happens in special-relativistic time dilation, which is equivalent to $mathrm{d}t'/mathrm{d}t$ across two different inertial frames. Fortunately, we can do something similar here.

Space expands everywhere, also here. And time is inseparable from space. Does this mean that time also "expands" as in changing its pace? ... In a similar way that the expansion of space is compared relative to, well, to itself I suppose.

A spatially isotropic and homogeneous universe has the metric in the form
$$mathrm{d}s^2 = -mathrm{d}t^2 + a^2(t)mathrm{d}Sigma^2text{,}$$
where $a(t)$ is the scale factor and $mathrm{d}Sigma^2$ is the metric of an isotropic and homogeneous Riemannian manifold: the 'open' hyperbolic $3$-plane, the flat Euclidean $3$-space, or the 'closed' $3$-sphere (or real projective $3$-space, but that's usually not considered because it's non-orientable). If the scale factor is ever zero in the past, the cosmological time for this is conventionally chosen to be $t = 0$.

The cosmological time measures the proper time of an observer at rest relative to the bulk of the matter in the universe, so in some sense it's the most intuitive choice of a time coordinate, but like all coordinates, it's not sacred. We can, for example, define a conformal time coordinate $eta$ such that $mathrm{d}eta = mathrm{d}t/a$, in which the metric takes the form
$$mathrm{d}s^2 = a^2(eta)left[-mathrm{d}eta^2 + mathrm{d}Sigma^2right]text{,}$$
and so all of the dimensions of spacetime are affected by cosmic expansion in the same way. Therefore, I think conformal time satisfies the requirements in your question, although it is not measured by any local clock.

Is the changing rate of time also astronomically observable?

The scale factor is astronomically observable, and $mathrm{d}eta/mathrm{d}t = 1/a$, so yes.

How did time behave during the radical inflation shortly after Big Bang?

The conformal time essentially uses the particle horizon as a measure of time, i.e. the furthest distance from which an ideal lightlike signal could have travelled since $t = 0$ in order to reach the observer by the present time. During inflation, the particle horizon rapidly expanded.

molecular biology - Does anyone have any TOPO directional cloning tips?

I have lots of experience with the TOPO TA kit which is very similar to the kit your using. Here's a link to the TOPO Directional cloning product page which shows a schematic of the enzymatic ligation.

From your comments, you said you have doubly-digested the PCR product. This is likely your point of failure unless you are absolutely confident that your enzymes work at blunt ended DNA (which I can almost guarantee does not work). Restriction digestion of PCR products will only work if there are at least a few bases on either side of the recognition site so that the restriction enzyme is able to "grab on" to the DNA. What you are mixing instead, is blunt-ended PCR product DNA + cohesive-ended vector. This will not work under any circumstances as is.

There is a simple solution.

Add 3'-A overhangs to your PCR product directly. The back of the TOPO manual tells you how to do this as well as many other sources. Ligate this using your TOPO kit to produce a shuttle vector that you can then doubly digest your insert out and gel purify it. Then you may ligate this purified, digested DNA with your previously digested destination vector.

Note that in my hands and in others in our lab, topoisomerase is unstable and has a short half-life. It is especially sensitive to temperature changes (warming from -20°C to 4°C) which you wouldn't expect since it is designed to work at room temperature. The vector is not affected, but without a working topoisomerase, the ligation step does not occur and the DNA does not transform.

As an aside: If you plan on doing more cloning in the future and need to replace the kit, I would recommend getting the basic TOPO TA cloning kit, clone your PCR product (with 3'-A overhangs) into the vector, transform, pick white/light blue colonies for screening then cut out from the TOPO vector (the shuttle vector) for downstream applications. The fact that it is directionally cloned or not into the TOPO vector is of no consequence unless it also happens to be your destination vector.

which or what kind of star has a very stable luminosity?

Hipparchos numbers of the 26 most stable stars known:
2021, 2854, 5542, 16611, 19747, 24927, 32537, 38414, 42913, 45556, 50191, 57363, 71053, 73555, 74666, 76440, 74946, 90139, 94648, 96052, 10239, 102488, 104732, 111169, 116631, 118322.

Compare Hpmax and Hpmin: They differ 0.01. Standard error e_Hpmag is 0.0003 mag.
There are 681 stars in the Hipparchos catalog with an amplitude of 0.01 mag.

More detail in this paper, including a link to the appropriate VizieR query.

human biology - Why do we get runny noses in the cold?

Rhinorrhea, or runny nose is a response used by our nasal membrane to get rid of foreign particles including pollen dust and infection. As such we get runny noses when we have a cold, allergy or are exposed to high densities of air-born particles. Cold air may irritate our nasal membranes, both because of temperature differences relative to our body and due to the lower amounts of moisture cold air holds. Cold air thus also results in a runny nose.

solar system - Would the existence of Planet Nine rule out the possibility of a sixth giant planet?

I'm aware that there have been attempts to simulate the evolution of the Solar System with six giant planets¹, as opposed to the traditional four or five. The recent proposed Planet Nine would probably invalidate some of those models, although I don't know how drastic its effects would be.

Would Planet Nine fit into models with six giant planets? Have any simulations been done that support such a scenario?

---

^{1 The models I'm most familiar with were created by Nesvorny & Morbidelli (2012).}

Does the mass of the observable universe ever change?

Even if you're only referring the "ordinary" matter (such as stars, gas, and bicycles) and dark matter, the mass of the observable Universe does increase, not because mass is being created, but because the size of the observable Universe increases. In a billion years from now, we can see stuff that today is too far away for the light to have reached us, so its radius has increased. Since the mass $M$ equals density $rho_mathrm{M}$ times volume $V$, $M$ increases.

As called2voyage mentions, we have several ways of measuring the density, and we know it's close to $3times10^{-30},mathrm{g},mathrm{cm}^{-3}$. The radius is $R = 4.6times10^{28},mathrm{cm}$, so the mass is
$$M = rho_mathrm{M} frac{4pi}{3}R^3 simeq 10^{57},mathrm{g},$$
or $5times10^{23}M_odot$ (Solar masses).

However, another factor contributes to the mass increase, namely the so-called dark energy, which is a form of energy attributed to empty space. Since the Universe expands, dark energy is being created all the time.

Solar Eclipses for dummies: Step 1 - moon equatorial orbit around a planet without axial tilt

1. Every new moon would be a total solar eclipse.

Incorrect. Even if the Earth had no axial tilt and the Moon had an equatorial orbit, that doesn't mean that every new moon would be a total solar eclipse. Yes, the moon would always generate some kind of an eclipse at every new moon, but it's orbit shape hasn't changed -- it's still an ellipse. It's further at some points in its orbit and closer at others. When it's further away at new moon, it appears smaller than the sun in the sky, making an annular (ring) eclipse, not a total eclipse.

2. The path of totality would always cover the same area: a 250km wide corridor with its centre at the equator (so 125km over the northern hemisphere and 125km over the southern hemisphere).

For the same reason as (1), the path of totality would vary from a maximum amount down to nothing. For annular eclipses there would be a similar path of annularity instead. But whichever path it is would always be centered on the equator.

3. I think the path of totality wouldn't always cover the same area, e.g. always over Africa, so Q1: Is there a simple formula to predict which areas would be in the path of totality?

I'm sure that there are formulas that would predict which areas would be in the path of totality/annularity, but they would not be simple. They would depend on exactly when new moon occurs and the exact distance of the moon from the earth. That would control which strip along the equator would see the eclipse and how wide it would be. Because the moon slows down in its orbit when it's further away from the earth, and it speeds up in its orbit when it's closer to the earth, the time between new moons is not constant. The fact that Earth's own orbit around the sun is also elliptical, and it also slows down/speeds up when it is far/close from/to the Sun complicates this as well.

4. In real life, the moment of totality can vary from seconds to seven minutes. But in my study example, Q2: the period of totality should always be the same, right? Because the crossing path of moon and sun is always the same (while in real life the Moon can overlap the Sun at different angles and going in different directions) Q3: How can I calculate this period of time?

Again, because of the elliptical orbit of the Moon, the length of totality or annularity still can vary. Even during a single eclipse, the length of totality depends on your exact location on Earth. Your exact location determines your exact distance from the moon during the eclipse, which will vary depending on whether the Moon is getting closer/farther and how fast. There are formulas for calculating this, but I'm sure they are quite complicated even with the moon orbiting over the equator and with Earth having no axial tilt.

5. What about the latitudes for whom the solar eclipse would only be seen as partial? I understand that the nearest to the path of totality, the more covered the sun will be, and vice-versa. Q4: Is there a set value that says e.g. for each km, another degree is visible?

Generally, the closer you are to the equator, the more the sun would be covered. But this would vary slightly depending on the distance of the Moon from the Earth, and it wouldn't depend solely on your latitude. As Gerald points out, the moon's shadow, in which you would see a total solar eclipse, is cone-shaped. Different points on the Earth close to the equator would experience a different cross-section of the cone, which may be narrower or wider depending on your exact location. Where the eclipse is partial, the apparent size of the moon would control how much of the Sun is covered. A further-away moon would appear smaller in the sky and thus cover less of the Sun. Close to the borderline where the Moon appears to graze the Sun, the Moon may miss the Sun entirely if it's far enough and it appears small enough.

binary star - Can close binaries have a very eccentric orbit?

There are surprisingly many examples of short period, eccentric binry systems.

A very incomplete list would include

KIC4544587 P=2.19 d e=0.288 +/- 0.026 Hambleton et al. (2013)

HD174884 P=3.66 d e=0.2939 +/- 0.0005 Maceroni et al. (2010)

CoRoT 102918586 P=4.39 d e=0.249 +/- 0.005 Maceroni et al. (2013)

HD313926 P=2.27d e=0.209 +/-0.001 Rucinski et al. (2007)

In each of these cases, the stars are relatively warm, with thin (if any) subphotospheric convection zones. Tidal circularisation is much more effective in stars with thick convection zones (giants, or cooler main sequence stars). Therefore it is possible that all of these objects (and, as I say, there are many other examples) are too young to have circularised.

Some theory is presented by Zahn et al. (2005). Indeed, circularisation times are very short - basically you expect everything with a solar mass or below to be circularised if its period is less than 6 days, but the process is less efficient for higher mass stars. Circularisation will essentilly take place during pre-main-sequence evolution. Since a circular orbit represents the minimum energy configuration, the only way you are going to get non-circular orbits in solar-type and lower mass stars is if they are very young (less than some tens of millions of years), the binary system formed after their pre-main-sequence evolution or if there is an injection of energy via a dynamical interaction or an eccentric third body in a much wider orbit.

gravity - Use Pluto's gravitation to reach the next dwarf planet

That's pretty much what they're planning to do -- except that the planned target is a smaller Kuiper Belt Object, not a dwarf planet.

UPDATE : I overestimated the course change possible by using Pluto's gravity. See David Hammen's answer for the details.

After the Pluto flyby, the current plan is for New Horizons to continue on its path and fly by one or two Kuiper Belt objects (KBOs). Two such objects have been identified as possible targets. As far as I can tell a selection has not yet been made. One is estimated to be about 30-45 kilometers in diameter; the other is likely somewhat larger.

The choice of target is tightly constrained by available fuel for course adjustments. Before October 2014, there were no known bodies beyond the Pluto system that New Horizons would be able to reach. A search was conducted using ground telescopes, and later the Hubble Space Telescope.

Once a target is chosen, the flight path will be adjusted during the Pluto flyby to ensure that it passes near the selected object. Pluto's gravity will have to be taken into account when planning the course correction.

It's not clear that this would be a "slingshot". The goal is not necessarily to increase the spacecraft's velocity, as was done by the Jupiter flyby in 2006; rather it will select whatever course is needed to reach the target.

A flyby of a another dwarf planet after leaving the Pluto system is, unfortunately, not feasible. The choice of targets past Pluto is tightly constrained by fuel, distance, and time. The spacecraft has only a very limited amount of hydrazine propellant available for maneuvers, and it can't effectively return good science data past about 55 AU. This limits available targets to a cone less than 1 degree wide. There just aren't any dwarf planets past Pluto that New Horizons is able to reach. Only three objects past Pluto have been officially recognized as dwarf planets; a handful of others are likely.

This information is summarized from the Wikipedia article.

Infrared telescopes, magnitude and observations

Currently 22-23 magnitude could be the limit to make a spectrum for ground based 10m class telescopes, 21-22 magnitude may be easy for them.
4m class telescopes could possibly handle 20 magnitude, I am not sure.
2m could be appropriate for stars brighter than 16magnitude generally.

What about the infrared bands: J H K W1 W2 respectively? Are there any empirical values or references?

star - Does the sun have a feature like the red spot on Jupiter?

The Sun has lots of features "like the red spot", but they are dissimilar too.

Similarities: The Sun's photosphere - the bit we can see - is entirely gaseous; the photosphere rotates differentially with solar latitude; the gas is turbulent. There are features that can be seen quite easily - these are the dark magnetic sunspots, typically of size a few thousand km; and the pattern of bright points surrounded by dark lanes, known as granulation, typical sizes of order 100 km.

These features are associated with the convective upwelling of hotter material from below. In sunspots that process is inhibited by magnetic fields so that the surface temperature is lower and that area looks dark in comparison to the rest of the photosphere. Granulation is the visible appearance of the tops of the upwelling convective cells.

However, these phenomena are short-lived compared with the GRS on Jupiter. Sunspots have lifetimes of maybe a month or two and then the magnetic fields are reordered by the Sun's differential rotation and sheared apart. Granulation is ever present but the detailed pattern shifts on timescales of hours as different convective cells rise and fall.

Why is there a difference between the cosmic event horizon and the age of the universe?

From the link you provide:

The particle horizon differs from the cosmic event horizon, in that the particle horizon represents the largest comoving distance from which light could have reached the observer by a specific time, while the event horizon is the largest comoving distance from which light emitted now can ever reach the observer in the future. The current distance to our cosmic event horizon is about 5 Gpc, well within our observable range given by the particle horizon.

Your confusion somes from the fact that you are mixing to different horizons:

The particle horizon is the sphere centered on us that has a radius equal to the distance that light can travel in 13.8 Gyr (the age of the Universe). That is, light that was emitted when the Universe was born at a point on that horizon, reaches us today. Note that, because the Universe is expanding, the distance is not 13.8 Gly, or 4.2 Gpc, as one might naively expect, but in fact 47 Gly.

The cosmic event horizon is also a sphere centered on us, which holds all points from which light, if it is emitted today, it will reach us in the future. If it is emitted outside this horizon, the expansion of the Universe ensures that the light will never reach us.

As time goes, we will see light that came from farther and farther away, and thus the distance to the particle horizon is increasing. Meanwhile, the accelerating expansion of the Universe ensures that light emitted from distant galaxies in the future are able to reach us only if they are increasingly closer. Thus the distance to the event horizon is decreasing.

You can see the particle and the event horizons as blue and red lines in the plot in @Pulsar's great answer here.

The 16 Gly that the distance to the event horizon is today is sort of a coincidence. It has nothing to do with the age of the Universe. It only depends on the future expansion of the Universe, which in turn depends on the densities of the components of the Universe ($Omega_mathrm{b},Omega_mathrm{DM},Omega_Lambda$, etc.). If the Universe has been dominated by matter (or radiation), then there would be no event horizon: No galaxy, ever-so far away would not be visible to us, if we just had the patience to wait. A galaxy is 10,000 billion lightyears away? Just wait long enough (exactly how long depends on the actual density).

However, our Universe happens to be dominated by dark energy, which accelerates the expansion without boundaries. This unfortunately means that the light leaving today from a galaxy 17 Gly away will be carried away by the expansion faster than it can travel toward us. In contrast, the light emitted today from a galaxy 15 Gly away will travel in our direction, but will nonetheless initially move away from us due to the expansion. However, its journey toward us makes this expansion rate smaller and smaller (since the expansion rate increases with distance from us), and after a period of time it will have traveled so far that it has overcome expansion and starts decreasing its distance from us and eventually reach us after 100 Gyr or so.

the sun - How to read 5 degree data of green line intensity

The format of the files seems to be described in this file, the content of which I've included below.

The annual files (1939-1993) contain the green coronal emission line
530.3 nm observations.  The coronal intensities are given in millionths
of intensity of the solar disk (coronal units) and converted to the
photometrical scale of Lomnicky Stit Station at a height of 40" above
the solar limb.

Several stations were used in this database with Lomnicky Peak being the
primary station since 1965.

Reference:  Rybansky, et al, 1994, Solar Physics 152, p 153-159.

Data format:

 COLUMN  FORMAT   DESCRITPION
  1-  2    I2     Year, last two digits
  3-  4    I2     Month
  5-  6    I2     Day
  7-  8    2X     Blank
      9    I1     Coronal station code:
                  0 - Interpolated data
                  1 - Lomnicky Stit
                  2 - Sacramento Peak
                  3 - Norikura
                  4 - Kislovodsk
                  5 - Pic Du Midi
                  6 - Wenselstein
                  7 - Arosa
                  8 - Kanzelhohe
 10- 13    I4     Time of the observation in hours (or zero)
 14- 17    I4     Time of the observation in minutes (or zero)
 18-305  72(I4)   Coronal intensities (72 values) from 0 degrees to 355
                  degrees of position angle in increments of 5 degrees.

Using the first row data as an example...

DATE        SC  H   M   1   2   3   4   5   6   7   8   9   10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72
-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
19390101    0   0   0   0   0   0   0   0   0   0   0   3   3   3   8   15  22  34  41  52  46  40  52  68  59  49  35  17  8   3   3   0   0   0   0   0   0   0   0   0   0   0   0   0   0   0   3   3   6   8   12  19  31  40  50  47  43  38  53  73  71  65  56  47  38  24  17  12  6   0   0   0   0   0   0

19390101 is the date (1939-01-01).
The first zero (Marked as SC) is the station code, the second the recorded hour, and the third the recorded minute (H/M). Most of this is 0 due to being interpolated data.

After this information, there are 72 remaining columns (numbered 1-72 above), which represents collected data consolidated in groups of 5 degrees, presumably starting at 0.

Given the amount of interpolation of old data the value may be questionable, but newer data appear to be more complete.

The data format might be a little overwhelming to work with, but you can organize it in excel quite easily - paste it in and each line break will form a row, then use the text-to-column function to break each data into its own column.

molecular biology - Has anyone tried Gibson Assembly Optimizations?

I also haven't tried it, but theoretically GC-rich sequences will interfere with Gibson assembly. Since unique homology between the ends is key to the assembly process, repetitive sequences which cause non-unique overhangs will increase the possibility of incorrectly ordered assembly. One solution would be to use alternative codons where possible to decrease repetitiveness.

I'm sure all the overlap design tools will try to avoid repetitive overlaps. Prof Jim Hasselhoff at Cambridge Plant Science is a big proponent of Gibson assembly, it was one of his students who wrote Gibthon. If you email him I'm sure he'll give you specific advice.

human biology - Does arterial blood always flow away from the heart?

Is there a negative net flow of blood in human arteries at any point of the cardiac cycle? I realise that blood flow can be turbulent, e.g. in the aorta or around stenotic arteries, but then the average is still flowing away from the heart.

The question was provoked by this graph, which admittedly I haven't seen in its context:

A similar graph showed negative velocities in the aorta and innominate artery of humans.

gravity - Precision of geocentric gravitational constant

Ignoring details such as the oblateness of the Earth, atmospheric drag, third body influences such as the Moon and the Sun, relativity, ..., the period of a satellite of negligible mass (even the International Space Station qualifies as a "satellite of negligible mass") is $T=2pisqrt{frac {a^3}{mu_mathrm{Earth}}}$. Neither Newton's gravitational constant nor the mass of the Earth are involved in this expression. This means that, ignoring those details, calculating $mu_mathrm{Earth}$ is merely a matter of calculating a satellite's rotational period and its semimajor axis.

Humanity has lots and lots of artificial satellites in orbit, and the people who model the orbits of those satellites don't ignore those details. A few of those satellites were specially designed to enable the determination of the Earth's non-spherical gravitational field (e.g., GRACE and GOCE), and a few were specially designed to enable extremely precise orbit determination (e.g., LAGEOS). Even with all of those details, the Earth's gravitational parameter is a directly inferable quantity (i.e., knowledge of G is not required). Moreover, the value is known to a very high degree of precision.

The Earth's mass? Not so much. The most precise way to "weigh the Earth" is to divide the high precision Earth's gravitational parameter by the low precision universal gravitational constant G. There's a problem here, which is the notoriously low precision of the gravitational constant when expressed in SI units.

stellar evolution - Variables in the Instability Strip

I was thinking about the possibility of determining what phase of evolution a variable star is in when it is located in the instability strip (say, a Cepheid object). Can you differentiate whether it is evolving toward the blue (in HR diagram) or back toward the giant branch?

I was looking at a figure recently in Carroll and Ostlie's Intro to Astrophysics text, which brought this to mind. It shows on the HR diagram where Cepheids lie, which is right in this strip.

accretion discs - Minimum Mass Solar Nebulae Scaling Factors

Attempt to do an intuitive explanation:

The Sun was formed from a cloud of matter. A small amount of that matter remained around the Sun, and had a similar composition. This was the solar nebulae.

But the composition of the planets are now not the same as the Sun. This is explained by that some of the matter was collected by the Sun, and some of it was blown out of the system.

That was only the light stuff! like hydrogen and helium. Most iron and other metals are conjectured to have remained in orbit, forming the planets.

As the Sun is representative for the original composition (partly at least, stellar fusion has skewed the hydrogen/helium ratio). So if iron is 0.14% of the Sun, that is also the original abundance in the nebulae. So all the iron in the planetary bodies is 0.14% of the original nebulae mass.

From that you can calculate the original mass. It is a 'minimum' because some of the iron may have escaped as well.

exoplanet - What's the name for [the other kind of planet] in a binary star system?

Astronomy currently only gives us the names circumbinary (left picture) and Trojan planet (unpictured, planet is around a Lagrange point), but from circumbinary we can extrapolate other names:

• circumunary - revolves around one star


• circumtrinary/circumternary - revolves around a trinary/ternary star system

Technically, there is another term that actually has some use: circumsystem. This is used for objects that revolve around a multiple star system regardless of the number of stars within the system.

mars - Where to obtain Tycho Brahe's data?

The page I referred to in my question lists the reference

Brahe, Tycho. Edited by I.L.E. Dreyer Tychonis Brahe Dani Opera Omnia. (in Latin) Vol 1-15. 1913-1929. (contains the observations in Tycho's notebooks)

Now this page is supposed to be an electronic version of Tycho's book. It says

Opera omnia, edidit I.L.E. Dreyer

in the big title at the bottom of the page. However, browsing through the book, I find the title

Tychonis Brahe Dani Scripta Astronomica.

I don't see words "opera omnia" anywhere. Is that the correct book? The first observation listed in that Excel file is

1582 DIE 12 NOUEMBRIS, MANE. Declinatio [MS] 23 7 B

Ok. So, on page 174, it does say something about the year 1582. However, the given coordinates do not appear, and neither does the date 12th November. The Excel file also refers to the Mars sign, which I cannot find from that page at all.

I hope someone could help from here :)

orbit - Accuracy of Laplace Method for determining orbital elements

Recently I had to implement Laplace method and apply it to 3 observations of Mars (10 days in between two observations). The results were pretty good, with discrepancies with real data well below 5% in most of the orbital elements.

I supposed that Laplace method was very accurate, so I tried to apply it to an asteroid (CASLEO, 5387). The 3 observations were also 10-days spaced but now the results widely diverge from the real orbital elements.

I expected it to be less accurate than in the Mars case since the observations covered less fraction of the orbit, but some of the elements were quite far from expected.

So my question is: What is the accuracy of the Laplace Method? Is it really that sensitive to the distance?

On a log-log plot of surface gravity to planet mass, what is the meaning of the y-intercept?

I think what you have established here is just that $rho$ tends to increase with mass. The density of planets isn't constant.

Let $rho = rho_0 (M/M_{earth})^{alpha}$, so that $M = (4/3)pi R^{3} rho_0 (M/M_{earth})^{alpha}$

Then
$$g = frac{GM}{R^2} = frac{4pi G}{3} R rho$$

Replace $R$ with $(3M/4pi rho)^{1/3}$ so that
$$ g = frac{4pi G}{3} left(frac{3M}{4pi rho}right)^{1/3} rho$$
$$ g = left(frac{4pi}{3}right)^{2/3} G M^{1/3} rho_0^{2/3} (M/M_{earth})^{2alpha/3}$$
$$ g = left(frac{4pi}{3}right)^{2/3} GM_{earth}^{1/3} rho_0^{2/3} (M/M_{earth})^{(2alpha+1)/3}$$

So, bar a (highly possible) algebraic slip, if you plot $log g$ vs $log M$, the gradient is $(2alpha+1)/3$, which from your plot, gives $alpha simeq 0.92$ - i.e. the average planet density increases almost linearly with mass.

The intercept then is
$$ b = log left[ left(frac{4pi}{3}right)^{2/3} GM_{earth}^{1/3} rho_0^{2/3}right],$$
which yields $rho_0 simeq 3.5$ kg/m$^3$ (NB: I subtracted 2 from your $b$ to make it SI; giving a density of around 814 kg/m$^3$ at a Jupiter mass).

The fact that density is almost proportional to mass can be found from the same dataset. e.g. see below. Below 0.1 Jupiter masses, the relationship appears to break down, though in actual fact very few of the densities for such planets are very accurately measured (since it requires a radius from a transit), but it works well enough in the range you have plotted. The physics here is that gas giants are governed by a partially (electron) degenerate equation of state that results in them all having a similar radius from about a tenth of a Jupiter mass to about 50 Jupiter masses (albeit with considerable and largely unexplained scatter). Thus the density is proportional to mass. This relationship does not work for small rocky planets, where the radius decreases for smaller masses. Thus your nice line in log space does not continue to lower masses (see plot at bottom - NB: some of the low-mass points have huge uncertainties).

entomology - Do insects with compound eyes have depth perception?

"1001 questions answered about insects" by Alexander Barrett and Elsie Broughton Klots includes the following passage:

Do insects have depth perception? Depth perception of some sort is important to an animal who has to catch its prey; fortunately most
insects have it to a degree. Although they do not have binocular
vision that can be compared with man's, it is true that when one eye
is covered their depth perception is markedly affected. The criterion
of depth seems to depend on the angle of simultaneous stimulation of
two corresponding points of the retina of the two eyes.

However it does not mention compound eyes specifically.

There may be other methods of obtaining a perception of distance rather than the binocular vision seen in humans. This paper suggests that there is 'clear evidence' that some insects perceive depth by moving their head to artificially create parallax, which they can then recognise and interpret as depth and distance. They cite the Praying Mantis as an example, which does have compound eyes.

How does water move throughout plants?

Most water moves up through the xylem by capillary action. Imagine dipping a pipette into a small pool of water; the water would rush up into the pipette. Or, imagine dipping the edge of a paper towel in water. The water "runs" up the paper towel. This is capillary action.

As water evaporates out of the leaves and such in higher regions of the plant, a capillary force pulls up more water. If for instance, you were to dry the top of your saturated paper towel, more water would be pulled up from the pool below to wet that top section.

As for a molecular explanation, Wikipedia has a good explanation of Cohesion-tension theory.

biochemistry - What is the mechanism that directs myosin walking?

Myosin, dynein and kinase all "walk" towards specific ends of the microtubule or actin filament they are on. I'm most familiar with the walking mechanism for myosin, where ATP fuels conformal changes in the binding region, but I don't understand how it chooses to go one direction over another. Actin fibers' positive and negative ends are fueled by the addition of G-actin via ATP and its subsequent reduction to ADP, so I suspect that this process is somehow involved in determining the direction of myosin's movement.

As just a secondary thought, are there differences in the mechanisms of the movement between the three walking molecules listed above?

natural satellites - If Venus had moon before and it fell back to Venus, why don't I see a unique, very big crater?

Venus has volcanism and weather, and those can cover or erode craters. There are relatively few impact craters on Venus today, indicating that the surface of Venus is at most 600 million years old -- meaning that any older surface features have been erased. The Earth's surface is even younger.

During the Late Heavy Bombardment, in the very early history of the Solar System, there was a period of time when many asteroids hit the Moon, creating many large impact craters. It seems likely that the Earth and Venus got hit by many asteroids then, too. Yet, no evidence of these craters is visible on Earth or Venus today. So, if Venus had a moon and that moon crashed into Venus thousands of millions of years ago, then the impact crater would likely have been erased by now.

And if Venus got hit by a sufficiently large object, then the energy of the impact might melt the entire surface of Venus, so that no lasting crater can form.

So, absence of very big craters from Venus is not evidence that Venus never had big moons.

spectroscopy - Why do linear velocity redshifts correspond to linear pixel shifts when the spectra are binned in constant log wavelength?

All this means is that you need to bin your spectra in equal intervals of log wavelength for each pixel to be a constant interval in velocity.

First consider the case whereeachpixel is worth a constant interval in linear wavelength. Here we have
$$ frac{Delta lambda}{lambda} = frac{Delta v}{c},$$
and the $Delta v$ represented by each pixel depends on $lambda$, which changes across the spectrum.

But now if you bin in equal increments of
$$Delta log lambda = frac{Delta lambda}{lambda} = frac{Delta v}{c}$$
and each pixel has the same fixed velocity interval, $Delta v = c Delta loglambda$, independent of $lambda$.

This log wavelength binning is a prerequisite for cross-correlation procedures that yield velocities.

naming - Who gets to name Planet Nine if it is confirmed?

The cited answer is correct insofar as the IAU is not the body that makes names of celestial bodies official. However, it's authority is implicit because it is recognized by the astronomical community and the public as the foremost authority on astronomical naming, and thus the names the IAU adopts are the ones most commonly used in the scientific community (excluding objects referred to by their catalog numbers).

From one of their information pdfs:

The IAU has been the official arbiter of planetary and satellite naming since its inception in 1919. The IAU’s decisions are officially adopted by the nearly 11 000 professional astronomers who are its members, coming from more than 90 countries.

. . .

The IAU does not consider itself as having a monopoly on the naming of celestial objects — anyone can in theory adopt names the way they choose. However, given the publicity and emotional investment associated with these discoveries, worldwide recognition is important and the IAU offers its unique experience for the benefit of a successful public naming process (which must remain distinct, as in the past, from the scientific designation issues).

The IAU may reach out to the public for naming suggestions, or it may taken case-by-case suggestions by individuals. So while Batygin and Brown can call the ninth planet whatever they want - they've informally referred to it as "Phattie" - public consensus will largely rest on the results of the IAU's decision, which could, of course, end up taking a suggestion of the pair.

Anyone can come up with a suggestion, although sometimes that's a terrible idea.